A Deep Mutational Scan of human Calmodulin using functional complementation in yeast.
Created
June 29, 2018
Last updated
Aug. 8, 2019
Published June 29, 2018
Member of urn:mavedb:00000001
·
urn:mavedb:00000001-c-2Although we now routinely sequence human genomes, we can confidently identify only a fraction of the sequence variants that have a functional impact. Here, we developed a deep mutational scanning framework that produces exhaustive maps for human missense variants by combining random codon mutagenesis and multiplexed functional variation assays with computational imputation and refinement. We applied this framework to four proteins corresponding to six human genes: UBE2I (encoding SUMO E2 conjugase), SUMO1 (small ubiquitin-like modifier), TPK1 (thiamin pyrophosphokinase), and CALM1/2/3 (three genes encoding the protein calmodulin). The resulting maps recapitulate known protein features and confidently identify pathogenic variation. Assays potentially amenable to deep mutational scanning are already available for 57% of human disease genes, suggesting that DMS could ultimately map functional variation for all human disease genes.
A Deep Mutational Scan of Calmodulin (CALM1) using functional complementation in yeast was performed using DMS-TileSeq and a machine-learning method was used to impute the effects of missing variants and refine measurements of lower confidence. See Weile et al. 2017 for details.
Name: CALM1
Type: Protein coding
Organism: Homo sapiens
Reference genome: hg38
Reference assembly: Other/Synthetic
Reference sequence: ATGGCTGATCAGCTGACCGAAGAACAGATTGCTGAATTCAAGGAAGCCTTCTCCCTATTTGATAAAGATGGCGATGGCACCATCACAACAAAGGAACTTGGAACTGTCATGAGGTCACTGGGTCAGAACCCAACAGAAGCTGAATTGCAGGATATGATCAATGAAGTGGATGCTGATGGTAATGGCACCATTGACTTCCCCGAATTTTTGACTATGATGGCTAGAAAAATGAAAGATACAGATAGTGAAGAAGAAATCCGTGAGGCATTCCGAGTCTTTGACAAGGATGGCAATGGTTATATCAGTGCAGCAGAACTACGTCACGTCATGACAAACTTAGGAGAAAAACTAACAGATGAAGAAGTAGATGAAATGATCAGAGAAGCAGATATTGATGGAGACGGACAAGTCAACTATGAAGAATTCGTACAGATGATGACTGCAAAATGA
DOI: No associated DOIs
Raw reads:urn:mavedb:00000001-c-1
Human Calmodulin DMS-TileSeq
A Deep Mutational Scan of human Calmodulin using functional complementation in yeast via DMS-TileSeq.
urn:mavedb:00000001-c-2
Human Calmodulin imputed and refined
A machine-learning imputed and refined Deep Mutational Scan of human Calmodulin using functional complementation in yeast.